plekhg2

Ensembl ID:
ENSDARG00000058459
ZFIN ID:
ZDB-GENE-090819-1
Human Orthologue:
PLEKHG2
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 2 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Plekhg2
Mouse Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 2 Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8685 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081333 Essential Splice Site 315 358 9 11
ENSDART00000081334   None 282 None 7
Genomic Location (Zv9):
Chromosome 15 (position 19302793)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20405419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAAGAGATTGATCGTAGAAAACCATCCTGCATCCTTGCCTCAAAAAG[T/C]AATAACAGTATTTAATGCATTACTGTGTAAAACTGCCCAACATTTCAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link