arnt2

Ensembl ID:
ENSDARG00000058449
ZFIN ID:
ZDB-GENE-001207-3
Description:
Aryl hydrocarbon receptor nuclear translocator 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9DG12]
Human Orthologue:
ARNT2
Human Description:
aryl-hydrocarbon receptor nuclear translocator 2 [Source:HGNC Symbol;Acc:16876]
Mouse Orthologue:
Arnt2
Mouse Description:
aryl hydrocarbon receptor nuclear translocator 2 Gene [Source:MGI Symbol;Acc:MGI:107188]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8259 Nonsense Mutation detected in F1 DNA During 2014
sa20863 Nonsense Mutation detected in F1 DNA During 2014
sa15572 Nonsense Available for shipment Available now
sa20864 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11162 Nonsense Available for shipment Available now
sa20865 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129575 Nonsense 91 738 5 20
ENSDART00000130997 None None 586 None 15

The following transcripts of ENSDARG00000058449 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 11554849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTGGTCTGCGTGCAGAGAGAATCACAGCGAGATCGAGCGGCGCAGA[C/T]GAAATAAAATGACGCAGTACATCACCGAGCTGTCGGACATGGTACCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129575 Nonsense 270 738 8 20
ENSDART00000130997 Nonsense 119 586 3 15

The following transcripts of ENSDARG00000058449 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 11591830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGTTTCAGGTGTGGCAGTGCACCTTTGGATCACATCTCATTGAAT[C/T]GATTGTCCAGCATGAGAAAGAGATACAGGTATGTTTGAAAGATTCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129575 Nonsense 368 738 11 20
ENSDART00000130997 Nonsense 217 586 6 15

The following transcripts of ENSDARG00000058449 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 11614265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCCTTTCRCGCCACAATTCGGATGGCATCWTCACAKTYGTGGACCCT[C/T]GATGCATCAACGTGATTGGCTACCAACCTCAGGTCATTATCACMTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129575 Essential Splice Site 404 738 13 20
ENSDART00000130997 Essential Splice Site 253 586 8 15

The following transcripts of ENSDARG00000058449 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 11638530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGGGGACAATAAAGTGTAAACAAACAAACAAATGTTTCTTGTGAAT[A/G]GGTGGTGAAGCTGAAAGGCCAGGTTCTCTCAGTGATGTACCGCTTCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129575 Nonsense 524 738 16 20
ENSDART00000130997 Nonsense 373 586 11 15

The following transcripts of ENSDARG00000058449 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 11665279)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTCNNNGATGATGTWTTGTGTGTKTTTATGTGTGTTCAGCTGAAAAG[A/T]ARATGATGGTTCCCTCATCCACCTCTGGCGGGCAGCAGTTGTATTCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129575 Essential Splice Site 658 738 None 20
ENSDART00000130997 Essential Splice Site 506 586 None 15

The following transcripts of ENSDARG00000058449 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 11672899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCGGAAACGCCTACTCCAACCTCGCCAATCGCAACACTGCTTTCGG[T/A]AAGAAAATCTGCTCATTCATTATAATACATGACTACATTGCTCATTGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mo214f3l