pdgfab

Ensembl ID:
ENSDARG00000058424
ZFIN ID:
ZDB-GENE-060929-124
Description:
platelet derived growth factor alpha b [Source:RefSeq peptide;Acc:NP_001070225]
Human Orthologue:
PDGFA
Human Description:
platelet-derived growth factor alpha polypeptide [Source:HGNC Symbol;Acc:8799]
Mouse Orthologue:
Pdgfa
Mouse Description:
platelet derived growth factor, alpha Gene [Source:MGI Symbol;Acc:MGI:97527]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11805 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055993 Nonsense 112 230 4 7

The following transcripts of ENSDARG00000058424 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 12321411)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12794244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTAGAGGAGGCGGTGCCGGCCATGTGCAAGACCCGGACGGTGATYTA[C/A]GAGATCCCCCGCAGTCAAGTRGATCCCACTGCTGCAAACTTCCTCATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link