lgi1b

Ensembl ID:
ENSDARG00000058421
ZFIN IDs:
ZDB-GENE-060217-1, ZDB-GENE-060217-1
Description:
leucine-rich, glioma inactivated 1b [Source:RefSeq peptide;Acc:NP_001122241]
Human Orthologue:
LGI1
Human Description:
leucine-rich, glioma inactivated 1 [Source:HGNC Symbol;Acc:6572]
Mouse Orthologue:
Lgi1
Mouse Description:
leucine-rich repeat LGI family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861691]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19023 Nonsense Mutation detected in F1 DNA During 2016
sa41952 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22016 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081298 Nonsense 9 543 2 9
ENSDART00000126667 Nonsense 17 551 2 9
Genomic Location (Zv9):
Chromosome 12 (position 5667712)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5155326
KASP Assay ID:
2260-4901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACATACACACACCCGCGCAGGATGGGATATGCGAACAGGAGCATA[A/T]GAGCATACACTTTTCTGTTGTGGGTCGCAGCGGTCCTGCTGTTTGCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081298 Essential Splice Site 160 543 6 9
ENSDART00000126667 Essential Splice Site 168 551 6 9
Genomic Location (Zv9):
Chromosome 12 (position 5660141)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5162897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACGTTGCCCAGAGATATATTCAAAGGAATGGATGCCTTAACAAAAGT[G/A]TACGTATTTGACCAATAAAGTCCAGTATTCTTTGCACTGTGAAAGAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081298 Essential Splice Site 160 543 6 9
ENSDART00000126667 Essential Splice Site 168 551 6 9
Genomic Location (Zv9):
Chromosome 12 (position 5660140)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5162898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGTTGCCCAGAGATATATTCAAAGGAATGGATGCCTTAACAAAAGTG[T/A]ACGTATTTGACCAATAAAGTCCAGTATTCTTTGCACTGTGAAAGAAGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link