lgi1b

Ensembl ID:
ENSDARG00000058421
ZFIN IDs:
ZDB-GENE-060217-1, ZDB-GENE-060217-1
Description:
leucine-rich, glioma inactivated 1b [Source:RefSeq peptide;Acc:NP_001122241]
Human Orthologue:
LGI1
Human Description:
leucine-rich, glioma inactivated 1 [Source:HGNC Symbol;Acc:6572]
Mouse Orthologue:
Lgi1
Mouse Description:
leucine-rich repeat LGI family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861691]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19023 Nonsense Mutation detected in F1 DNA During 2014
sa22016 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081298 Nonsense 9 543 2 9
ENSDART00000126667 Nonsense 17 551 2 9
Genomic Location:
Chromosome 12 (position 5667712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACATACACACACCCGCGCAGGATGGGATATGCGAACAGGAGCATA[A/T]GAGCATACACTTTTCTGTTGTGGGTCGCAGCGGTCCTGCTGTTTGCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081298 Essential Splice Site 160 543 6 9
ENSDART00000126667 Essential Splice Site 168 551 6 9
Genomic Location:
Chromosome 12 (position 5660140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGTTGCCCAGAGATATATTCAAAGGAATGGATGCCTTAACAAAAGTG[T/A]ACGTATTTGACCAATAAAGTCCAGTATTCTTTGCACTGTGAAAGAAGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jwumnf6z