gcn1l1

Ensembl ID:
ENSDARG00000058419
ZFIN ID:
ZDB-GENE-040724-264
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B5DE37]
Human Orthologue:
GCN1L1
Human Description:
GCN1 general control of amino-acid synthesis 1-like 1 (yeast) [Source:HGNC Symbol;Acc:4199]
Mouse Orthologue:
Gcn1l1
Mouse Description:
GCN1 general control of amino-acid synthesis 1-like 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:244424

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6092 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21180 Essential Splice Site Available for shipment Available now
sa34283 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 851 2669 23 61
Genomic Location (Zv9):
Chromosome 8 (position 3766384)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3512867
KASP Assay ID:
554-3859.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGATCCAGCTGGAGAAAGAGTCTACTATCCGCAAGCGTCTGCAGGAG[G/A]TGAGAGCTCATACAGCAGCAGCAGTGATGGTCTGAGCTGCGCTGATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Essential Splice Site 851 2669 23 61
Genomic Location (Zv9):
Chromosome 8 (position 3766385)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3512868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCCAGCTGGAGAAAGAGTCTACTATCCGCAAGCGTCTGCAGGAGG[T/C]GAGAGCTCATACAGCAGCAGCAGTGATGGTCTGAGCTGCGCTGATCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081272 Nonsense 1650 2669 39 61
Genomic Location (Zv9):
Chromosome 8 (position 3796715)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3543697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCATAGATTTACTGTGTGTATGCGTTTTCAGGATCTGTCTCCGTATT[T/A]GCCCAGTGTGATTCCAGGCCTCAAAGCATCTCTGCTGGACCCTGTGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link