ENSDARG00000058416

Ensembl ID:
ENSDARG00000058416

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16433 Nonsense Available for shipment Available now
sa13097 Nonsense Available for shipment Available now
sa17550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081296 Nonsense 230 921 1 4
Genomic Location:
Chromosome 11 (position 12958498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTRCAACTGCTGACAWGTGGAAGACAATAAAGTGCCAAAAAGCTGCA[C/T]AACTGCAMTATTTGTGCCAGCTTATYAATGAWAATTCCACAGATTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081296 Nonsense 645 921 3 4
Genomic Location:
Chromosome 11 (position 12959792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGAYGAAGAAGAACAAAATATTTTAAGAAATGSAGTGAAAGATGAGT[T/A]GCAGCATCAAGGATTTCAYGCAGACGCACAGAWGCTTGATAATGTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081296 Nonsense 917 921 4 4
Genomic Location:
Chromosome 11 (position 12960660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MGGATTACTGAGGGTTTGCAGGAAATAACGAGTTTCATTAAGATTCTTTG[T/A]GCGCTTTTGGAACATTCGGGGAAGGGAGGAGCCTCCAAATTCACTTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/97n1gnrn