acbd5b

Ensembl ID:
ENSDARG00000058410
ZFIN ID:
ZDB-GENE-070705-18
Description:
Acyl-CoA-binding domain-containing protein 5-B [Source:UniProtKB/Swiss-Prot;Acc:A5WV69]
Human Orthologue:
ACBD5
Human Description:
acyl-CoA binding domain containing 5 [Source:HGNC Symbol;Acc:23338]
Mouse Orthologue:
Acbd5
Mouse Description:
acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1921409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19683 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081253 Nonsense 322 418 9 12
ENSDART00000140434 Nonsense 322 410 10 12
Genomic Location:
Chromosome 2 (position 9724605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGGAGATGGTGGTCAGCGCGGGGAGACGGCAGACAGAATGGACAAA[C/T]AGGCCATCAACACACAGATCACCACCATATTGTCGGAGCTGGAGGACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bs7lecwu