
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
acbd5b
- Ensembl ID:
- ENSDARG00000058410
- ZFIN ID:
- ZDB-GENE-070705-18
- Description:
- Acyl-CoA-binding domain-containing protein 5-B [Source:UniProtKB/Swiss-Prot;Acc:A5WV69]
- Human Orthologue:
- ACBD5
- Human Description:
- acyl-CoA binding domain containing 5 [Source:HGNC Symbol;Acc:23338]
- Mouse Orthologue:
- Acbd5
- Mouse Description:
- acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1921409]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19683 | Nonsense | Available for shipment | Available now |
sa25760 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19683
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081253 | Nonsense | 322 | 418 | 9 | 12 |
ENSDART00000140434 | Nonsense | 322 | 410 | 10 | 12 |
- Genomic Location (Zv9):
- Chromosome 2 (position 9724605)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 10137888 GRCz11 2 9935708 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCAAGGAGATGGTGGTCAGCGCGGGGAGACGGCAGACAGAATGGACAAA[C/T]AGGCCATCAACACACAGATCACCACCATATTGTCGGAGCTGGAGGACAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25760
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081253 | Essential Splice Site | 356 | 418 | 9 | 12 |
ENSDART00000140434 | Essential Splice Site | 356 | 410 | 10 | 12 |
- Genomic Location (Zv9):
- Chromosome 2 (position 9724710)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 10137993 GRCz11 2 9935813 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGATGTTCTTCGCAGACTGACCACACTGGAACAGCTTACAGCGTCACAA[G/A]TATGACCAGCACCCAAATTCCTTTTCATCATACATCGTCATGATTAAGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: