si:ch211-167j6.5

Ensembl ID:
ENSDARG00000058409
ZFIN ID:
ZDB-GENE-070912-147
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34572 Nonsense Mutation detected in F1 DNA During 2018
sa45348 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081270 Nonsense 99 289 4 8
ENSDART00000136417 Nonsense 29 215 1 5
Genomic Location (Zv9):
Chromosome 9 (position 13172656)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12925221
GRCz11 9 12896424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCCAGGATCCCGCAGTGCCATTACCTGTCTAGGAGATTCCTGCCGCT[G/A]GCCCAAAGCTGTGGACGGATTTGTGTATGTACCATACATCATGTCCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081270 Nonsense 158 289 6 8
ENSDART00000136417 Nonsense 88 215 3 5
Genomic Location (Zv9):
Chromosome 9 (position 13175262)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12927827
GRCz11 9 12899030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTATTTATTTACTAATAAAATACCTCACTGTTTGTCCCGTCAGCTG[C/A]TGGTCATATCTGGGAATGACAGGAGGCAGTCAGACGGTCTCTCTGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link