chrna4

Ensembl ID:
ENSDARG00000058393
ZFIN ID:
ZDB-GENE-090505-3
Description:
cholinergic receptor, nicotinic, alpha 4 [Source:RefSeq peptide;Acc:NP_001041528]
Human Orthologue:
CHRNA4
Human Description:
cholinergic receptor, nicotinic, alpha 4 [Source:HGNC Symbol;Acc:1958]
Mouse Orthologue:
Chrna4
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:87888]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
e47 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
e47
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104115 Nonsense 94 627 4 6
Genomic Location:
Chromosome 11 (position 13219300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGCGCACATGTTTCCCTGCAGGAGTGGAACGACTACAAGCTGCGCT[G/A]GAACCCAGAGGAGTATGAGAATGTCACCTCCATCAGGATCCCCTCTGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9zzrs0z5