otpb

Ensembl ID:
ENSDARG00000058379
ZFIN ID:
ZDB-GENE-990708-7
Description:
Homeobox protein orthopedia B [Source:UniProtKB/Swiss-Prot;Acc:Q6DGH9]
Human Orthologue:
OTP
Human Description:
orthopedia homeobox [Source:HGNC Symbol;Acc:8518]
Mouse Orthologue:
Otp
Mouse Description:
orthopedia homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:99835]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45228 Nonsense Mutation detected in F1 DNA During 2018
sa115 Nonsense Available for shipment Available now
sa12381 Nonsense Available for shipment Available now
sa8966 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081249 Nonsense 77 315 2 3
ENSDART00000134606 Nonsense 90 328 2 3
Genomic Location (Zv9):
Chromosome 5 (position 53472100)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50972032
GRCz11 5 51618625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAAGTAATGGTGGATCCAATCCTAATGGAATGCAGCAGGTCAACGCC[A/T]AAGACCAAGAAAAGCAGCAACAGCAAAACTCCAATCAGACGGGCGGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081249 Nonsense 83 315 2 3
ENSDART00000134606 Nonsense 96 328 2 3
Genomic Location (Zv9):
Chromosome 5 (position 53472082)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50972014
GRCz11 5 51618607
KASP Assay ID:
554-1251.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATCCTAATGGAATGCAGCAGGTCAACGCCAAAGACCAAGAAAAGCAG[C/T]AACAGCAAAACTCCAATCAGACGGGCGGCCAGCAAAACCAACAGAAACAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081249 Nonsense 213 315 3 3
ENSDART00000134606 Nonsense 226 328 3 3
Genomic Location (Zv9):
Chromosome 5 (position 53470550)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50970482
GRCz11 5 51617075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACGACACTCGCTGGGCCGCGGCTGGGATGCCGGGGGTCTCACAGCTG[C/T]AGATACCGCCGTCGCTKGGTCGAYAGCAGGCGATGGCACAGTCCCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081249 Nonsense 221 315 3 3
ENSDART00000134606 Nonsense 234 328 3 3
Genomic Location (Zv9):
Chromosome 5 (position 53470526)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50970458
GRCz11 5 51617051
KASP Assay ID:
2259-6520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGATGCCGGGGGTCTCACAGCTGCAGATACCGCCGTCGCTKGGTCGA[C/T]AGCAGGCGATGGCACAGTCCCTGTCTCARTGCAGTCTCGGAGCGGGTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link