ttc6

Ensembl ID:
ENSDARG00000058377
ZFIN ID:
ZDB-GENE-090429-2
Human Orthologue:
TTC6
Human Description:
tetratricopeptide repeat domain 6 [Source:HGNC Symbol;Acc:19739]
Mouse Orthologue:
Ttc6
Mouse Description:
tetratricopeptide repeat domain 6 Gene [Source:MGI Symbol;Acc:MGI:2684915]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5900 Nonsense Mutation detected in F1 DNA During 2016
sa36337 Nonsense Mutation detected in F1 DNA During 2016
sa36338 Nonsense Mutation detected in F1 DNA During 2016
sa25035 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17451 Nonsense Available for shipment Available now
sa42874 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081247 Nonsense 129 612 4 13
ENSDART00000081247 Nonsense 129 612 4 13
Genomic Location:
Chromosome 17 (position 10323366)
KASP Assay ID:
554-3715.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTCTCTTCTCCTTCAGGCTTTGGATGCTTTTAACAGCACTGTGAGCT[T/G]RAACCCAGACCATGCCGAGGCTCACCATCAGCGAGGCCTTTGTCGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081247 Nonsense 129 612 4 13
ENSDART00000081247 Nonsense 129 612 4 13
Genomic Location:
Chromosome 17 (position 10323366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTCTCTTCTCCTTCAGGCTTTGGATGCTTTTAACAGCACTGTGAGCT[T/A]AAACCCAGACCATGCCGAGGCTCACCATCAGCGAGGCCTTTGTCGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081247 Nonsense 140 612 4 13
Genomic Location:
Chromosome 17 (position 10323398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACAGCACTGTGAGCTTAAACCCAGACCATGCCGAGGCTCACCATCAG[C/T]GAGGCCTTTGTCGCATTCATTTACAAGACTCCACAGGCGTGCAAGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081247 Essential Splice Site 215 612 5 13
Genomic Location:
Chromosome 17 (position 10323740)
KASP Assay ID:
554-7351.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCTCAGAGCACACTTGTATAAAGGGGCTCTTAAATTCTATTTGAAAG[T/C]TAGTAAAAATAGCACCATTTTGAGCATAATTATCGTACACTTGAGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081247 Nonsense 377 612 9 13
Genomic Location:
Chromosome 17 (position 10329497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGCCCAGAGGGACTTCCTCTCAGCCCTCCATCTCAATCCACTCTGCT[T/A]GAGTGCCCGCATTAGCCTGGCAYACAATTTACAGGTAGAGTCAAAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081247 Nonsense 385 612 9 13
Genomic Location:
Chromosome 17 (position 10329522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTCCATCTCAATCCACTCTGCTTGAGTGCCCGCATTAGCCTGGCATA[C/A]AATTTACAGGTAGAGTCAAAATAATTGTCTTGCTTCTTCTTGTTTCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link