krt5

Ensembl ID:
ENSDARG00000058371
ZFIN ID:
ZDB-GENE-991110-23
Description:
keratin 5 [Source:RefSeq peptide;Acc:NP_571231]
Human Orthologues:
KRT8, KRT8P11
Human Descriptions:
keratin 8 pseudogene 11 [Source:HGNC Symbol;Acc:31058]
keratin 8 [Source:HGNC Symbol;Acc:6446]
Mouse Orthologue:
Krt8
Mouse Description:
keratin 8 Gene [Source:MGI Symbol;Acc:MGI:96705]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37628 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29880 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa31083 Nonsense Mutation detected in F1 DNA During 2017
sa43920 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081223 Essential Splice Site 264 561 3 10
ENSDART00000081327 Essential Splice Site 251 553 3 9
ENSDART00000129044 Essential Splice Site 264 566 3 9
ENSDART00000144280   None 201 None 3
ENSDART00000146185 Essential Splice Site 60 226 3 7
Genomic Location (Zv9):
Chromosome 23 (position 10282223)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10240364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAACAAGCGTGCCGCAGTGGAAAATGAATTTGTCCTGCTGAAGAAGG[T/G]AAAACCTTCATCTGCTGTGTTGATTTTTATTTAAAATAGTTATTACTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081223 Essential Splice Site 516 561 None 10
ENSDART00000081327 Missense 503 553 9 9
ENSDART00000129044 Missense 516 566 9 9
ENSDART00000144280   None 201 None 3
ENSDART00000146185   None 226 None 7
Genomic Location (Zv9):
Chromosome 23 (position 10280831)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10238972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATACGGTGGTGGCAGTGGATTCGGTGGTGGCAGTGGATACGGTGGTG[G/A]CAGTGGTTTCGGAGGTGGCAGTGGATTTGGATATGGTGGTGGCTCAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081223 Nonsense 522 561 10 10
ENSDART00000081327 Nonsense 514 553 9 9
ENSDART00000129044 Nonsense 527 566 9 9
ENSDART00000144280   None 201 None 3
ENSDART00000146185   None 226 None 7
ENSDART00000081223 Nonsense 522 561 10 10
ENSDART00000081327 Nonsense 514 553 9 9
ENSDART00000129044 Nonsense 527 566 9 9
ENSDART00000144280   None 201 None 3
ENSDART00000146185   None 226 None 7
Genomic Location (Zv9):
Chromosome 23 (position 10280797)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10238938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATACGGTGGTGGCAGTGGTTTCGGAGGTGGCAGTGGATTTGGATA[T/A]GGTGGTGGCTCAGGGATGTCGATTGGTGGCGGCTCTGGCATGAGCATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081223 Nonsense 522 561 10 10
ENSDART00000081327 Nonsense 514 553 9 9
ENSDART00000129044 Nonsense 527 566 9 9
ENSDART00000144280   None 201 None 3
ENSDART00000146185   None 226 None 7
ENSDART00000081223 Nonsense 522 561 10 10
ENSDART00000081327 Nonsense 514 553 9 9
ENSDART00000129044 Nonsense 527 566 9 9
ENSDART00000144280   None 201 None 3
ENSDART00000146185   None 226 None 7
Genomic Location (Zv9):
Chromosome 23 (position 10280797)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10238938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATACGGTGGTGGCAGTGGTTTCGGAGGTGGCAGTGGATTTGGATA[T/A]GGTGGTGGCTCAGGGATGTCGATTGGTGGCGGCTCTGGCATGAGCATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link