hspb8

Ensembl ID:
ENSDARG00000058365
ZFIN ID:
ZDB-GENE-030131-2480
Description:
heat shock protein, alpha-crystallin-related, b8 [Source:RefSeq peptide;Acc:NP_001094427]
Human Orthologue:
HSPB8
Human Description:
heat shock 22kDa protein 8 [Source:HGNC Symbol;Acc:30171]
Mouse Orthologue:
Hspb8
Mouse Description:
heat shock protein 8 Gene [Source:MGI Symbol;Acc:MGI:2135756]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20369 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081230 Essential Splice Site None 145 None 3
ENSDART00000134206   None 216 1 3
Genomic Location (Zv9):
Chromosome 5 (position 17593626)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15319586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGAGATCTGAGGCGAAATTCTTTTAAACTTTATCTTGGAGAAACAGG[T/C]TAGTTTAAGTTTTTAAAGAGCTTTTATTCATATACCTGACATTAACTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link