krt8

Ensembl ID:
ENSDARG00000058358
ZFIN ID:
ZDB-GENE-030411-5
Description:
Keratin, type II cytoskeletal 8 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWF6]
Human Orthologues:
KRT8, KRT8P11
Human Descriptions:
keratin 8 pseudogene 11 [Source:HGNC Symbol;Acc:31058]
keratin 8 [Source:HGNC Symbol;Acc:6446]
Mouse Orthologue:
Krt8
Mouse Description:
keratin 8 Gene [Source:MGI Symbol;Acc:MGI:96705]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1629 Nonsense Available for shipment Available now
sa31084 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa1629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081215 Nonsense 6 520 1 9

The following transcripts of ENSDARG00000058358 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 10360380)
KASP Assay ID:
554-1570.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCTCTACAAGACAGAAAACACACAAGGCAGGATGTCCACCTACAGC[A/T]AGAAAACCAGCTACACCGTCAAGTCTTCTTCCTCTGGATCTATCCCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081215 Essential Splice Site 439 520 8 9

The following transcripts of ENSDARG00000058358 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 10356728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGACTGGCAACTGGAATCAAGGCCATCAATATCTCAAAACAGAGCA[G/A]TAAGTTTGACTCCTTTCAAGACTCTTCCTTCACATAATAATTCAATGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7zpn2w8d