krt8

Ensembl ID:
ENSDARG00000058358
ZFIN ID:
ZDB-GENE-030411-5
Description:
Keratin, type II cytoskeletal 8 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWF6]
Human Orthologues:
KRT8, KRT8P11
Human Descriptions:
keratin 8 pseudogene 11 [Source:HGNC Symbol;Acc:31058]
keratin 8 [Source:HGNC Symbol;Acc:6446]
Mouse Orthologue:
Krt8
Mouse Description:
keratin 8 Gene [Source:MGI Symbol;Acc:MGI:96705]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1629 Nonsense Available for shipment Available now
sa37629 Nonsense Mutation detected in F1 DNA During 2016
sa43921 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31084 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081215 Nonsense 6 520 1 9

The following transcripts of ENSDARG00000058358 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10360380)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10319182
KASP Assay ID:
554-1570.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCTCTACAAGACAGAAAACACACAAGGCAGGATGTCCACCTACAGC[A/T]AGAAAACCAGCTACACCGTCAAGTCTTCTTCCTCTGGATCTATCCCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081215 Nonsense 109 520 1 9

The following transcripts of ENSDARG00000058358 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10360071)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10318873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACAAGAGCCTCCTGGCACCTCTGAATCTGGAGATCGACCCCAACATC[C/T]AAATTGTCCGCACCCAGGAGAAAGAGCAAATCAAGACCCTCAACAACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081215 Essential Splice Site 132 520 1 9

The following transcripts of ENSDARG00000058358 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10359999)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10318801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGCAAATCAAGACCCTCAACAACCGCTTCGCTTCCTTCATTGACAAG[G/A]TAGGTTTGACATTTCTTTTTTTGGAGTTTTTTGGAGCAGAAAAGTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081215 Essential Splice Site 439 520 8 9

The following transcripts of ENSDARG00000058358 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10356728)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10315530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGACTGGCAACTGGAATCAAGGCCATCAATATCTCAAAACAGAGCA[G/A]TAAGTTTGACTCCTTTCAAGACTCTTCCTTCACATAATAATTCAATGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link