elovl1b

Ensembl ID:
ENSDARG00000058356
ZFIN ID:
ZDB-GENE-040426-2755
Description:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1b [Source:RefSeq pept
Human Orthologue:
ELOVL1
Human Description:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 [Source:HGNC Symbol;A
Mouse Orthologue:
Elovl1
Mouse Description:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21866 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081216 Nonsense 70 320 3 8
ENSDART00000128923 Nonsense 70 244 3 8
ENSDART00000138377 Nonsense 70 130 6 8
ENSDART00000139765 Nonsense 70 243 5 10
ENSDART00000145726 Nonsense 70 129 4 6
Genomic Location:
Chromosome 11 (position 13289859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGGCCAACCGTAAACCCTTTCAGCTGAAAGAAGCCATGATCATCTA[C/A]AACCTGTCCTTAGTCGGCCTGTCTGCATATATCGTATATGAGGTGAGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dju2f4dr