selt1a

Ensembl ID:
ENSDARG00000058354
ZFIN ID:
ZDB-GENE-030327-6
Description:
selenoprotein T1a [Source:RefSeq peptide;Acc:NP_840075]
Human Orthologue:
RP11-392O18.1
Human Description:
Selenoprotein T [Source:UniProtKB/Swiss-Prot;Acc:P62341]
Mouse Orthologue:
2810407C02Rik
Mouse Description:
RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081214 Essential Splice Site 153 193 5 7
Genomic Location (Zv9):
Chromosome 2 (position 9479600)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9892883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAAAATCAGTGCATGTCTACAGGCGCATTTGAAATCACGCTCAATGG[T/A]AAGCTTATTTGTAGATTAATATATTTTGATCTTTTGTATGTATATATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link