CSMD1

Ensembl ID:
ENSDARG00000058353
Description:
CUB and Sushi multiple domains 1 [Source:HGNC Symbol;Acc:14026]
Human Orthologue:
CSMD1
Human Description:
CUB and Sushi multiple domains 1 [Source:HGNC Symbol;Acc:14026]
Mouse Orthologue:
Csmd1
Mouse Description:
CUB and Sushi multiple domains 1 Gene [Source:MGI Symbol;Acc:MGI:2137383]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30372 Essential Splice Site Mutation detected in F1 DNA During 2015
sa24754 Nonsense Mutation detected in F1 DNA During 2015
sa30371 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa30372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059170 Essential Splice Site 59 875 1 17
ENSDART00000097148   None 353 None 9
Genomic Location:
Chromosome Zv9_scaffold3535 (position 231616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGCCAACAAGACCACAGGTGGTCAGGGCAAGCACCTGTGTGTGTTC[G/A]TAAGTAACTTTAAACAATATGAGTTCAAACGTTAATTGCTTATTTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059170 Nonsense 128 875 3 17
ENSDART00000097148   None 353 None 9
Genomic Location:
Chromosome Zv9_scaffold3535 (position 225111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGTTTTTTATCTTGCAGTGGTAAACTGCTCTGATCCGGGCTTTGTA[G/T]AGAACGCCATTCGTCATTCTCAACAGCGCTACCCTGAGAGCTTCAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059170 Nonsense 388 875 7 17
ENSDART00000097148   None 353 None 9
Genomic Location:
Chromosome Zv9_scaffold3535 (position 206924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACATCGGAAAAGAGTTCATATTCAACAAAACCGTCCACTATCGCTG[T/A]AACCCTGGTTATGAAATGGATCCCCTCGATTCATCTGTACTACGATGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e6upwqyz