LOC100150889

Ensembl ID:
ENSDARG00000058351
Human Orthologue:
TAPBPL
Human Description:
TAP binding protein-like [Source:HGNC Symbol;Acc:30683]
Mouse Orthologue:
Tapbpl
Mouse Description:
TAP binding protein-like Gene [Source:MGI Symbol;Acc:MGI:2384853]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9560 Nonsense Available for shipment Available now
sa22763 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22762 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081208 Nonsense 245 462 4 9
Genomic Location:
Chromosome 16 (position 11391139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAAAAGAGTCKGTCCCTGGGCAGGATGTGGCTCTGGAGTGGCGCCTT[C/T]WAYACAGAGGAAATGGCCGTAAAATTCTTGATATGAAGGCAAGGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081208 Essential Splice Site 268 462 4 9
Genomic Location:
Chromosome 16 (position 11391066)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTTGATATGAAGGCAAGGGAGATGGAGACAGAAATAGGATCAGATG[G/A]TGAGAATTATTCTGTAAACGAAGGTGAATTTTGTTTGGATGCTAAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081208 Essential Splice Site 269 462 5 9
Genomic Location:
Chromosome 16 (position 11390997)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAGGTGAATTTTGTTTGGATGCTAAATGTCAATATTATCGTACACTCC[A/C]GTATTCGTGGACCGGGAAAACACCAGCACTGAAGCAGATCTTCTAGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/76f2t67a