sass6

Ensembl ID:
ENSDARG00000058346
ZFIN ID:
ZDB-GENE-040426-2784
Description:
Spindle assembly abnormal protein 6 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVT3]
Human Orthologue:
SASS6
Human Description:
spindle assembly 6 homolog (C. elegans) [Source:HGNC Symbol;Acc:25403]
Mouse Orthologue:
Sass6
Mouse Description:
spindle assembly 6 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1920026]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43780 Nonsense Mutation detected in F1 DNA During 2017
sa5967 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081191 Nonsense 354 627 9 17
Genomic Location (Zv9):
Chromosome 22 (position 10854980)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10715148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGACCAGCTTGTGCTGAGGACCAAAGAAGTGCTGGAGGCCACGCAG[C/T]AGCAGAAGGTTAGAGAGCTTTGTGTGTGTGTGTGTGTGTGTGTATTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081191 Essential Splice Site 356 627 9 17
Genomic Location (Zv9):
Chromosome 22 (position 10854971)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10715139
KASP Assay ID:
554-3839.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTGTGCTGAGGACCAAAGAAGTGCTGGAGGCCACGCAGCAGCAGAAG[G/A]TTAGAGAGCTTTGTGTGTGTGTGTGTGTGTGTGTATTGGTAAATTATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link