grhl2a

Ensembl ID:
ENSDARG00000058342
ZFIN ID:
ZDB-GENE-050913-123
Description:
grainyhead-like 2a [Source:RefSeq peptide;Acc:NP_001025263]
Human Orthologue:
GRHL2
Human Description:
grainyhead-like 2 (Drosophila) [Source:HGNC Symbol;Acc:2799]
Mouse Orthologue:
Grhl2
Mouse Description:
grainyhead-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2182543]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42666 Nonsense Mutation detected in F1 DNA During 2017
sa25005 Nonsense Mutation detected in F1 DNA During 2017
sa22764 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088986 Nonsense 71 348 3 10
Genomic Location (Zv9):
Chromosome 16 (position 11422024)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9937074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTTGAAGATTTAATGTCGGAAAGTATCTCTTTTCCATTAGGTTCCT[A/T]AAGAGAAGAGGCTCCTGCCAGTGCACAAACTTCCAGAAGATCATGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088986 Nonsense 242 348 6 10
Genomic Location (Zv9):
Chromosome 16 (position 11417678)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9932728
KASP Assay ID:
554-7534.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCAAGCCGTTCTGTCCGTGAGAAGGCTGCCGATGGGCCGATGGTGTA[T/A]CTGAACAAGGGCCAGTTCTATGGCATCACACTCAGTGAGACCGGGGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088986 Essential Splice Site 270 348 6 10
Genomic Location (Zv9):
Chromosome 16 (position 11417592)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9932642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGACCGGGGCCAACAAGGGCCTTCGTCATCCCATCAGTAAAGTGCGGG[T/C]GAGTTCTGCTTGCCATGAAAACCACTATCAACTTCACATTAGAGACCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link