si:ch211-133j6.3

Ensembl ID:
ENSDARG00000058332
ZFIN ID:
ZDB-GENE-090312-205
Description:
LOC553479 protein [Source:UniProtKB/TrEMBL;Acc:Q502A4]
Human Orthologues:
AC090051.1, KRT18
Human Descriptions:
keratin 18 [Source:HGNC Symbol;Acc:6430]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JEA8]
Mouse Orthologue:
Krt18
Mouse Description:
keratin 18 Gene [Source:MGI Symbol;Acc:MGI:96692]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11708 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081193 Essential Splice Site 220 410 4 7
Genomic Location (Zv9):
Chromosome 23 (position 10460687)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10419489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGGGGCCTAAGATATAACCCTGTGSAACATCAAATCACCTATTTTTC[A/T]GGAATTGTCAGCACTAWATGGTCAAATTACCCAATCAGGAGTGCAAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link