neu3.3

Ensembl ID:
ENSDARG00000058327
ZFIN IDs:
ZDB-GENE-061103-511, ZDB-GENE-061103-511
Description:
sialidase 3.3 [Source:RefSeq peptide;Acc:NP_001071006]
Human Orthologue:
NEU3
Human Description:
sialidase 3 (membrane sialidase) [Source:HGNC Symbol;Acc:7760]
Mouse Orthologue:
Neu3
Mouse Description:
neuraminidase 3 Gene [Source:MGI Symbol;Acc:MGI:1355305]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23919 Essential Splice Site Available for shipment Available now
sa11219 Essential Splice Site Available for shipment Available now
sa23920 Nonsense Available for shipment Available now
sa37292 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081184 Essential Splice Site None 402 1 4
ENSDART00000084600 Essential Splice Site None 402 1 5
Genomic Location (Zv9):
Chromosome 21 (position 20755280)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21766773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGCTCTTGTGGTGTGAATCATTTGTTTTTGCAGCAGGAGTTTTTTT[G/A]TAAGTATTGCTTCTGATTAGTAAAGAATTATTGATATAGACAGAATCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081184 Essential Splice Site None 402 None 4
ENSDART00000084600 Essential Splice Site None 402 None 5
Genomic Location (Zv9):
Chromosome 21 (position 20755281)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21766774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCTCTTGTGGTGTGAATCATTTGTTTTTGCAGCAGGAGTTTTTTTG[T/C]AAGTATTGCTTCTGATTAGTAAAGAATTATTGATATARACAGAAWCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081184 Nonsense 13 402 3 4
ENSDART00000084600 Nonsense 13 402 3 5
Genomic Location (Zv9):
Chromosome 21 (position 20756007)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21767500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATTTTAAAAATGGGCAACAAGACACCGTCAAAAAGCAAATCAGGTTA[T/A]CCTAAAGAAATGAACACAACCACAGTATTCAAACAGGAGCAGCCTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081184 Nonsense 95 402 4 4
ENSDART00000084600 Nonsense 95 402 4 5
Genomic Location (Zv9):
Chromosome 21 (position 20758327)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21769820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATTGTTTTGTTTTGTTTCTTATTTATTCCAGTGGATCTGTGGTCAT[C/T]AGGTGCTAAGTTCAGCTAGTCTACCAAACCACCGCAGCATGAATCCATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link