enc1l

Ensembl ID:
ENSDARG00000058322
ZFIN ID:
ZDB-GENE-030131-5742
Description:
ectodermal-neural cortex (with BTB-like domain) [Source:RefSeq peptide;Acc:NP_001001402]
Human Orthologues:
ENC1, KLHL25
Human Descriptions:
ectodermal-neural cortex 1 (with BTB-like domain) [Source:HGNC Symbol;Acc:3345]
kelch-like 25 (Drosophila) [Source:HGNC Symbol;Acc:25732]
Mouse Orthologues:
Enc1, Klhl25
Mouse Descriptions:
ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]
kelch-like 25 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2668031]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5968 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050171 None None 273 3 4
ENSDART00000081183 Nonsense 424 589 2 3
Genomic Location:
Chromosome 22 (position 10895030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCWGTGTCTCTCAAACAAGTGGAGCAATACAACCCCCAATCCAACAAGT[G/A]GACTCTGGTAGCTCCTCTTCGAGAGGGTGTGAGCAACGCTGCGGTCGTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Morbidity-free survival: Genetic correlates of longevity and selected age-related phenotypes: a genome-wide association study in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bonqgkbg