prpf18

Ensembl ID:
ENSDARG00000058306
ZFIN ID:
ZDB-GENE-040704-45
Description:
Pre-mRNA-splicing factor 18 [Source:UniProtKB/Swiss-Prot;Acc:Q6GMH0]
Human Orthologue:
PRPF18
Human Description:
PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17351]
Mouse Orthologue:
Prpf18
Mouse Description:
PRP18 pre-mRNA processing factor 18 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36572 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081154 Essential Splice Site 121 342 4 10
Genomic Location (Zv9):
Chromosome 18 (position 7870114)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8447492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCAGAGACTCCGCAAGATTGAAATTCTGGCACCTGAAGTAAACAAG[G/A]TAAGACCCAGTCGCCATCTTGACACTGTTGGTGACCGGTGTGTTTTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link