cpt1b

Ensembl ID:
ENSDARG00000058285
ZFIN ID:
ZDB-GENE-041010-9
Description:
carnitine palmitoyltransferase 1B [Source:RefSeq peptide;Acc:NP_001005940]
Human Orthologue:
CPT1B
Human Description:
carnitine palmitoyltransferase 1B (muscle) [Source:HGNC Symbol;Acc:2329]
Mouse Orthologue:
Cpt1b
Mouse Description:
carnitine palmitoyltransferase 1b, muscle Gene [Source:MGI Symbol;Acc:MGI:1098297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7848 Nonsense Mutation detected in F1 DNA During 2014
sa7849 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081132 Nonsense 364 442 10 13
ENSDART00000083421 Nonsense 364 770 10 19
Genomic Location:
Chromosome 18 (position 7818337)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACGGTGGCCGCCACCTTTGGCCCTCAGAGCTGGAGCTCCAGTTTCAA[C/T]GAATCCTRGATGACAAGTCTGAACCTCAACCTGGAGAGCTCAAGCTRCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081132 None None 442 None 13
ENSDART00000083421 Nonsense 561 770 14 19
Genomic Location:
Chromosome 18 (position 7824095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACGGCTGCTTGTTTAATGAGTTTGGAAAGGGCCTGATAAAGAAATGC[A/T]GAACAAGTCCGGATGCTTTTATCCAGCTGGCACTGCAACTAGCTCAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Narcolepsy: Variant between CPT1B and CHKB associated with susceptibility to narcolepsy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/snyatyy1