EPHA5

Ensembl ID:
ENSDARG00000058284
Description:
EPH receptor A5 [Source:HGNC Symbol;Acc:3389]
Human Orthologue:
EPHA5
Human Description:
EPH receptor A5 [Source:HGNC Symbol;Acc:3389]
Mouse Orthologue:
Epha5
Mouse Description:
Eph receptor A5 Gene [Source:MGI Symbol;Acc:MGI:99654]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41602 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38783 Nonsense Mutation detected in F1 DNA During 2017
sa34860 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081140 Essential Splice Site 51 983 3 17
Genomic Location (Zv9):
Chromosome 10 (position 12478449)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 12597783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCTTTTTTTTTTTATGAAAAACTCTGTTTTTCTTGTTTTTTTTTTC[A/T]GTGGGAAGAAATCGGAGAGGTGGATGAGAACTATGCACCAATTCACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081140 Nonsense 80 983 3 17
Genomic Location (Zv9):
Chromosome 10 (position 12478540)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 12597874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACACATACCAAGTGTGCAAAGTGATGGAGCACAACCAGAACAACTG[G/A]TTGCAGACCAACTGGATATTAACCCAAGGTGCCCAGCGAGTGTTCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081140 Essential Splice Site 324 983 5 17
Genomic Location (Zv9):
Chromosome 10 (position 12539230)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 12658012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAACTTTATACATTTTGTAGTTAGGTTATAATACTCTTATCATATTTC[A/T]GGGCCTCCTTCTGCTCCACGTAATGCTATCTCCAACGTAAATGAAACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link