si:dkey-208b23.5

Ensembl ID:
ENSDARG00000058280
ZFIN ID:
ZDB-GENE-081104-362
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLM6]
Human Orthologue:
SPAG17
Human Description:
sperm associated antigen 17 [Source:HGNC Symbol;Acc:26620]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21219 Nonsense Available for shipment Available now
sa41140 Nonsense Mutation detected in F1 DNA During 2017
sa969 Splice Site, Nonsense Available for shipment Available now
sa9290 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31634 Nonsense Available for shipment Available now
sa7123 Nonsense Mutation detected in F1 DNA During 2017
sa18106 Nonsense Available for shipment Available now
sa27145 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34341 Nonsense Mutation detected in F1 DNA During 2017
sa21218 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 158 1612 5 42
ENSDART00000126551 Nonsense 166 1743 5 45
ENSDART00000129168 Nonsense 157 819 5 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13577832)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13023176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAACACAGAATATGAATATTTCAGGCCGTAGAGGAGAATGCTCATGTT[A/T]AAGTAGGACTGAATTCTGCCAATAAAGATCAGGGAGGTAAAGGAGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 246 1612 6 42
ENSDART00000126551 Nonsense 254 1743 6 45
ENSDART00000129168 Nonsense 245 819 6 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13577466)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13022810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGACTCAATGGGTATCCATGTGTCCAATGTTATTAAACTGGGTTTA[C/T]AGAGAGATGAACATTCAGAGGCTCTAGAGGACACAGAGGCAGAGGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 722 1612 18 42
ENSDART00000126551 Nonsense 737 1743 18 45
ENSDART00000129168 Splice Site None 819 None 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13570678)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13016022
KASP Assay ID:
554-0874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACYATCATGAGMAATCAATTGATTTATAATATCCTATAAACTGATTA[T/G]AAAAAGGGTAAYGAAGTGACCCTGACAGACCTCCAGGAGACCCTAATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Essential Splice Site 758 1612 19 42
ENSDART00000126551 Essential Splice Site 773 1743 19 45
ENSDART00000129168 Essential Splice Site 688 819 17 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13570491)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13015835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTTTAAAATCTATAAAAMAWTTAATTACASATGARTGTTTCTCTTTC[A/C]GGTCCTCCAATCTGCTTCYGAAATRTATAGATGTGTGGACACATTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 794 1612 19 42
ENSDART00000126551 Nonsense 809 1743 19 45
ENSDART00000129168 Nonsense 724 819 17 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13570381)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13015725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCGTGTATGTCATCTGCCACAATCCAATGAGCCAACAGAGGAGCTGC[A/T]AAGAATTCTGGGAAGGATCACTTCACACAGATGTGGGCTTCAGGTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 939 1612 22 42
ENSDART00000126551 Nonsense 954 1743 22 45
ENSDART00000129168   None 819 None 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13569096)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13014440
KASP Assay ID:
554-5303.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACATGTCCAAAACACCCAGCTCAGCTACAATGTCTAAAGAAAAGGCC[A/T]GAGACTTTCAAGAGATGTCACAAGAACCAGCAAACAATGATGTATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048   None 1612 None 42
ENSDART00000126551 Nonsense 1150 1743 28 45
ENSDART00000129168   None 819 None 20
ENSDART00000137784   None 413 None 11
Genomic Location (Zv9):
Chromosome 8 (position 13566246)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13011590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTGAAAATCATTTGGACAAGGAATATTTTGTCAACAAAATCACCTA[T/A]ACTGGCGTCACGGTGGCGCAATGGGTAGCAAGATCGCCTCATAGCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Essential Splice Site 1370 1612 35 42
ENSDART00000126551 Essential Splice Site 1510 1743 38 45
ENSDART00000129168   None 819 None 20
ENSDART00000137784 Essential Splice Site 83 413 2 11
Genomic Location (Zv9):
Chromosome 8 (position 13562709)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13008053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATGTTTTATGTCAAGTAACGGACTCAGAGTGGAATCACTTTCAGG[T/G]AGACTGAAGTAATATGTCTGAAAAAAAAAAAATATCTTGCACTAAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 1545 1612 41 42
ENSDART00000126551 Nonsense 1676 1743 44 45
ENSDART00000129168   None 819 None 20
ENSDART00000137784 Nonsense 242 413 6 11
Genomic Location (Zv9):
Chromosome 8 (position 13557583)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13002927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGAGAAGCCGTCAAAGTCTGATTCAGTCCACGTCCAACCAGTTTTA[G/T]AGTGTCCTGAAGTGCTGCTGGTGCGACAGATTACCCAGAATCCACCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081048 Nonsense 1591 1612 42 42
ENSDART00000126551 Nonsense 1722 1743 45 45
ENSDART00000129168   None 819 None 20
ENSDART00000137784 Nonsense 288 413 7 11
Genomic Location (Zv9):
Chromosome 8 (position 13554393)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12999737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCATATCTGGAGCAGTTGCTTCAGAGAGAGGCTCAGTGGGAGAAAATG[C/T]AGCTAAAGGATCCACGAACAGCACAGGAGAAGAGTCATCAGAATGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link