glmna

Ensembl ID:
ENSDARG00000058267
ZFIN ID:
ZDB-GENE-041114-120
Description:
glomulin [Source:RefSeq peptide;Acc:NP_001007416]
Human Orthologue:
GLMN
Human Description:
glomulin, FKBP associated protein [Source:HGNC Symbol;Acc:14373]
Mouse Orthologue:
Glmn
Mouse Description:
glomulin, FKBP associated protein Gene [Source:MGI Symbol;Acc:MGI:2141180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39778 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081094 Nonsense 374 592 12 19
ENSDART00000145770 Nonsense 374 592 11 18
Genomic Location (Zv9):
Chromosome 2 (position 10627100)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11052196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACCCTCCGTTTTCTCTTTAGAACTTGGTTAAAGTTATGACTATGTG[T/A]CCAGACCAGACTCTGGTAAGTATGAGGTTGTGTGTGGAGGTAAAATGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link