celsr1b

Ensembl ID:
ENSDARG00000058259
ZFIN ID:
ZDB-GENE-050823-4
Description:
Flamingo 1b [Source:UniProtKB/TrEMBL;Acc:Q4KP32]
Human Orthologue:
CELSR1
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr1
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12454 Nonsense Available for shipment Available now
sa11458 Essential Splice Site Available for shipment Available now
sa13613 Essential Splice Site Available for shipment Available now
sa426 Essential Splice Site Available for shipment Available now
sa10133 Nonsense Available for shipment Available now
sa12090 Nonsense Available for shipment Available now
sa24665 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Nonsense 1457 3006 4 35
Genomic Location:
Chromosome 25 (position 20279506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTTTTTTTRTTCATAGGTTTGCTACCAGGGAGCGAAATGCGCTTT[T/A]GCTGTATAATGGCAGGTTTAACGAAAAGCATGATTTCATTGCGATTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Essential Splice Site 1966 3006 14 35
ENSDART00000128852 Essential Splice Site 1966 3006 14 35
Genomic Location:
Chromosome 25 (position 20314801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTTCAAACGGGACTGYAATAAAACCACAGGAGAGTGTAGCTGCAAGG[T/C]AAGCAACAAGTGAKCACATGCTACACAAAACNAAAAAACTATRGAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Essential Splice Site 1966 3006 14 35
ENSDART00000128852 Essential Splice Site 1966 3006 14 35
Genomic Location:
Chromosome 25 (position 20314801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTTCAAACGGGACTGYAATAAAACCACAGGAGAGTGTAGCTGCAAGG[T/C]AAGCAACAAGTGAKCAMATGCTACACAAAACNAAAAAACTATRGAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Essential Splice Site 2439 3006 23 35
Genomic Location:
Chromosome 25 (position 20332366)
KASP Assay ID:
554-0374.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCATATGAGCAGCTTTGCCATCCTCATGGACATCTCCAAACGAGAGG[T/C]GAGACTTAATGAGCTATTGTGGTTTGTGGAGATCAAGGTTATAATAGTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Nonsense 2526 3006 25 35
ENSDART00000128852 Nonsense 2526 3006 25 35
Genomic Location:
Chromosome 25 (position 20335845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTTGTGGCCATTCTTCTACATTACTCATACATGTGCGCATTCGCCTG[G/A]ATGTTTGTGGAGGGGCTGCACATTTATCGAATGCTGACTGAGATGCGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Nonsense 2526 3006 25 35
ENSDART00000128852 Nonsense 2526 3006 25 35
Genomic Location:
Chromosome 25 (position 20335845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTTGTGGCCATTCTTCTACATTACTCATACATGTGCGCATTCGCCTG[G/A]ATGTTTGTGGAGGGGCTGCACATTTATCGAATGCTGACTGAGATGCGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128852 Nonsense 2632 3006 28 35
Genomic Location:
Chromosome 25 (position 20338300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGCAGGGTTTTTACATTGGTTATTTGCTGTTGTTCAGCTCTGCTCTT[C/T]GAGTGGCCTTTCTCCTCCTGCTGCTCATCAGCGCCACCTGGCTGCTGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dfkyiffi