C11orf53 (2 of 2)

Ensembl ID:
ENSDARG00000058254
Description:
chromosome 11 open reading frame 53 [Source:HGNC Symbol;Acc:30527]
Human Orthologue:
C11orf53
Human Description:
chromosome 11 open reading frame 53 [Source:HGNC Symbol;Acc:30527]
Mouse Orthologue:
1810046K07Rik
Mouse Description:
RIKEN cDNA 1810046K07 gene Gene [Source:MGI Symbol;Acc:MGI:1917059]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17449 Nonsense Available for shipment Available now
sa2816 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081105 Nonsense 196 282 5 5
Genomic Location:
Chromosome 15 (position 16766529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCTCTGGTGAAWCCTGAATCCACCAGCCCAACACAGTTCCGCTCGT[C/G]RTCCCGAGGGTCCAGCATGGYRTCCTCACAGTCCTAYTCTCTACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2816
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081105 Nonsense 273 282 5 5
Genomic Location:
Chromosome 15 (position 16766761)
KASP Assay ID:
554-3193.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCTGAGCGACGGTCTRGTATGGGGCAAAGAGGACACAGGCAGCAYATG[G/A]CCACAGTATGAGGTCAGGAGGGCATTCTGATATAKTCAGCTGTGAGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sgfnvc9b