cysltr1

Ensembl ID:
ENSDARG00000058246
ZFIN ID:
ZDB-GENE-050522-250
Description:
cysteinyl leukotriene receptor 1 [Source:RefSeq peptide;Acc:NP_001018484]
Human Orthologue:
CYSLTR1
Human Description:
cysteinyl leukotriene receptor 1 [Source:HGNC Symbol;Acc:17451]
Mouse Orthologue:
Cysltr1
Mouse Description:
cysteinyl leukotriene receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1926218]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42351 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081095 Nonsense 93 342 1 1
ENSDART00000134814 Nonsense 93 342 2 2
Genomic Location (Zv9):
Chromosome 14 (position 10660179)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10155536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAAGGGCAATGGAACCTGGGGGACTTCCTCTGCCGGCTGAGTTCCTA[T/A]GCACTCTATGTAAACCTCTACTGCAGTGTCTTCTTCATGATGGCTATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link