LOC561494

Ensembl ID:
ENSDARG00000058244
Human Orthologue:
IL17RA
Human Description:
interleukin 17 receptor A [Source:HGNC Symbol;Acc:5985]
Mouse Orthologue:
Il17ra
Mouse Description:
interleukin 17 receptor A Gene [Source:MGI Symbol;Acc:MGI:107399]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40249 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20233 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081089 Essential Splice Site 177 782 5 11
Genomic Location (Zv9):
Chromosome 4 (position 11386592)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12323219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAGACCACACCTTTTATAATGTTAGAAAAACATTTCAAGTTCCAGG[T/C]AGGTGACTCAATTAAAATACTCAATGCTCAAATGATTTTGCATGGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081089 Nonsense 270 782 9 11
Genomic Location (Zv9):
Chromosome 4 (position 11384526)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12321153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTAATGAATGCTCTTGAACTTATAAGTGCTTATTCAAATTTAGATC[C/T]AGCCATTTTTCCAAAAGTGTGCCAATGACTGTCGTCGAAAGAGCCACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link