nt5c2b

Ensembl ID:
ENSDARG00000058231
ZFIN IDs:
ZDB-GENE-061013-522, ZDB-GENE-061013-522
Description:
cytosolic purine 5'-nucleotidase [Source:RefSeq peptide;Acc:NP_001073435]
Human Orthologue:
NT5C2
Human Description:
5'-nucleotidase, cytosolic II [Source:HGNC Symbol;Acc:8022]
Mouse Orthologue:
Nt5c2
Mouse Description:
5'-nucleotidase, cytosolic II Gene [Source:MGI Symbol;Acc:MGI:2178563]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12322 Essential Splice Site Available for shipment Available now
sa25609 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065125 Essential Splice Site 35 562 3 18
ENSDART00000126286 Essential Splice Site 35 562 2 17
Genomic Location (Zv9):
Chromosome 1 (position 31300956)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31114416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGAAAATTGTTGCAGAAACATCTTTAACTGTTTTACTTTCTTCCCCA[G/T]AGTGTTTGTGAACAGAAGTCTGGCCATGKAAAAGATKAAATGCTTTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065125 Nonsense 532 562 18 18
ENSDART00000126286 Nonsense 532 562 17 17
Genomic Location (Zv9):
Chromosome 1 (position 31263401)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31076861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACATCGACTGCAAAAGAAACCAGCTCACACGCTCCATCAGCGAAATC[A/T]AACCACCGCATCTGTTCGCTCAACCACCACAGGAAATCACACACTGCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link