rps6kb1

Ensembl ID:
ENSDARG00000058230
ZFIN ID:
ZDB-GENE-040426-2038
Description:
ribosomal protein S6 kinase beta-1 [Source:RefSeq peptide;Acc:NP_998241]
Human Orthologue:
RPS6KB1
Human Description:
ribosomal protein S6 kinase, 70kDa, polypeptide 1 [Source:HGNC Symbol;Acc:10436]
Mouse Orthologue:
Rps6kb1
Mouse Description:
ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1270849]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9785 Nonsense Available for shipment Available now
sa12915 Essential Splice Site Available for shipment Available now
sa17324 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081059 Nonsense 99 502 4 15

The following transcripts of ENSDARG00000058230 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 16430842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGAAAGTATCTGGTGCTGCAACAGGAAAAATATTTGCAATGAAAGTCT[T/A]GAAGAAGGTTCAACATTCCTTGAATTCCCAATGCTAATTCATTTAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081059 Essential Splice Site 347 502 12 15

The following transcripts of ENSDARG00000058230 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 16439080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGATCTTCTTGCACGCAAAGTAGAACCACCATTCAAGCCTTTCTTGG[T/C]AACTATATTCATGTTTTGGGGTGTTTTGCTGGATCCTATTGGTTAAKAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081059 Essential Splice Site 383 502 None 15

The following transcripts of ENSDARG00000058230 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 16439278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCTGATGACTCCACACTGAGCGAAAGTGCAAATCAGGTCTTTTTGG[T/C]AAGGCAGCCAAGTCATGATTTCASTGTCCTCTATGAAAGCCTGTTTTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qsnsw02g