acot11

Ensembl ID:
ENSDARG00000058229
ZFIN ID:
ZDB-GENE-050522-538
Description:
acyl-coenzyme A thioesterase 11 [Source:RefSeq peptide;Acc:NP_001093445]
Human Orthologue:
ACOT11
Human Description:
acyl-CoA thioesterase 11 [Source:HGNC Symbol;Acc:18156]
Mouse Orthologue:
Acot11
Mouse Description:
acyl-CoA thioesterase 11 Gene [Source:MGI Symbol;Acc:MGI:1913736]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12527 Nonsense Available for shipment Available now
sa12500 Nonsense Available for shipment Available now
sa12913 Nonsense Available for shipment Available now
sa19688 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5

The following transcripts of ENSDARG00000058229 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10822815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCGTGTTGCCCTGCYATGCCAACCACTGCGGAGAGCTGAGCGTCGGG[C/T]AGCTGCTCAAATGGATGGACTGCACAGCATGTCTGTCTGGTGAGTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5

The following transcripts of ENSDARG00000058229 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10822815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCGTGTTGCCCTGCYATGCCAACCACTGCGGAGAGCTGAGCGTCGGG[C/T]AGCTGCTCAAATGGATGGACTGCACAGCATGTCTGTCTGGTGAGTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5
ENSDART00000076725 Nonsense 50 579 1 15
ENSDART00000081058 Nonsense 50 577 2 16
ENSDART00000145093 Nonsense 50 154 1 5

The following transcripts of ENSDARG00000058229 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10822815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCGTGTTGCCCTGCYATGCCAACCACTGCGGAGAGCTGAGCGTCGGG[C/T]AGCTGCTCAAATGGATGGACTGCACAGCATGTCTGTCTGGTGAGTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076725 Nonsense 290 579 8 15
ENSDART00000081058 Nonsense 288 577 9 16
ENSDART00000145093 None None 154 None 5

The following transcripts of ENSDARG00000058229 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10839582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATCTGTGGATTTGCAGTATGGAGGTTGGCGTCTGTGCAGAGGCGTA[T/A]ATTGGAGAGGAGCCTCTGAGGCACATTAACAGCGCCTTCATGACATTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pvwxpy8y