ak3

Ensembl ID:
ENSDARG00000058226
ZFIN ID:
ZDB-GENE-040426-2142
Description:
GTP:AMP phosphotransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_998295]
Human Orthologue:
AK3
Human Description:
adenylate kinase 3 [Source:HGNC Symbol;Acc:17376]
Mouse Orthologue:
Ak3
Mouse Description:
adenylate kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1860835]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13533 Nonsense Available for shipment Available now
sa1491 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081063 Nonsense 50 214 2 5
ENSDART00000132995 Nonsense 61 225 2 5
Genomic Location:
Chromosome 10 (position 10975930)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTRCATCTGGGCAGATTTGGGTCTCCTTATGAAGTCATGCATTGAT[C/T]AAGGTCAGTTGGTTCCTGATGATGTCATCTCTCGYCTCATCCTGTCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081063 Essential Splice Site 136 214 3 5
ENSDART00000132995 Essential Splice Site 147 225 3 5
Genomic Location:
Chromosome 10 (position 10974743)
KASP Assay ID:
554-1416.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCAGCGGCAGGGTCTATAATATAGATTTTAACCCACCCAAGAAACCAG[T/A]RAGTGCATGTTTACAACCCATTTAAKAGAACATCAGGATACTGTTAATTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ttmfk4c