mpp4a

Ensembl ID:
ENSDARG00000058222
ZFIN ID:
ZDB-GENE-070912-523
Human Orthologue:
MPP4
Human Description:
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) [Source:HGNC Symbol;Acc:13680]
Mouse Orthologue:
Mpp4
Mouse Description:
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) Gene [Source:MGI Symbol;Acc:MGI:238

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27359 Nonsense Mutation detected in F1 DNA During 2017
sa34581 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa27359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081049 Nonsense 291 587 9 17
ENSDART00000141194   None 260 None 6
ENSDART00000145775 Nonsense 281 307 9 11
Genomic Location (Zv9):
Chromosome 9 (position 13977825)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13730390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTAACTGAAGTTTTAATTCTTTTTTTGCAGCAAACAAAGGGAGCTGT[G/A]GTGGTCTCAACCTTATCAAGCTCACACCTGCATCAGACCCTGTACGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081049 Essential Splice Site 386 587 13 17
ENSDART00000141194 Essential Splice Site 59 260 2 6
ENSDART00000145775   None 307 None 11
Genomic Location (Zv9):
Chromosome 9 (position 13984446)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13737011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGGCTCACTGTCTGATTAAAGCCTTAATGCTTTTCCATTTTTTCCAC[A/G]GGTCCATCAGGAGTGGGTGTAAATGAACTAAGAAGGAGGCTAATCAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link