ugcg

Ensembl ID:
ENSDARG00000058221
ZFIN ID:
ZDB-GENE-030131-9885
Description:
ceramide glucosyltransferase [Source:RefSeq peptide;Acc:NP_001019378]
Human Orthologue:
UGCG
Human Description:
UDP-glucose ceramide glucosyltransferase [Source:HGNC Symbol;Acc:12524]
Mouse Orthologue:
Ugcg
Mouse Description:
UDP-glucose ceramide glucosyltransferase Gene [Source:MGI Symbol;Acc:MGI:1332243]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13602 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047954 Nonsense 233 438 6 9
Genomic Location:
Chromosome 10 (position 11052583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATGTGAAAAATAAACAGTTTTGTCCCATGTGGGATCCTGCAGGTTTA[T/G]TTTGGAACGTCACATCCTCGTTCCTACATCTCCGCCAATGTAACAGGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fenr0bo5