tubd1

Ensembl ID:
ENSDARG00000058219
ZFIN ID:
ZDB-GENE-040625-73
Description:
tubulin delta chain [Source:RefSeq peptide;Acc:NP_001002093]
Human Orthologue:
TUBD1
Human Description:
tubulin, delta 1 [Source:HGNC Symbol;Acc:16811]
Mouse Orthologue:
Tubd1
Mouse Description:
tubulin, delta 1 Gene [Source:MGI Symbol;Acc:MGI:1891826]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10009 Nonsense Available for shipment Available now
sa925 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113671 Nonsense 268 446 5 8
ENSDART00000146735 Nonsense 268 446 5 8
Genomic Location:
Chromosome 15 (position 16421010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTTACCTCCTTGGTGTGTCACCCAGAGTACAAACTGCTCAGCTTGTG[T/A]AAMATTCCTCAAATGTCTAGCACGTCACTGGCCTAKAGTGTGTTTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113671 Nonsense 280 446 5 8
ENSDART00000146735 Nonsense 280 446 5 8
Genomic Location:
Chromosome 15 (position 16420974)
KASP Assay ID:
554-0830.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCAGCTTGTGTAACATTCCTCAAATGTCTAGCACGTCACTGGCCTA[T/G]AGTGTGTTTAACTGGCCTGGTTTGCTCAAGCATCTGCGTCAGATGCTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gtbqe0gy