fam151a

Ensembl ID:
ENSDARG00000058218
ZFIN ID:
ZDB-GENE-070705-105
Description:
Protein FAM151A [Source:UniProtKB/Swiss-Prot;Acc:A5PN38]
Human Orthologue:
FAM151A
Human Description:
family with sequence similarity 151, member A [Source:HGNC Symbol;Acc:25032]
Mouse Orthologue:
Fam151a
Mouse Description:
family with sequence simliarity 151, member A Gene [Source:MGI Symbol;Acc:MGI:2657115]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8552 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19689 Essential Splice Site Available for shipment Available now
sa15963 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Essential Splice Site 163 599 3 8
Genomic Location:
Chromosome 2 (position 10870157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAACACTCTGGAGGAATGGCTGGATGCTGTRCTCAAGTCWAAGAAAG[G/A]TAAACAACATTGTCTGTTTTTCATACTCTGATGACATTGCGAACATTTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Essential Splice Site 383 599 8 8
Genomic Location:
Chromosome 2 (position 10861206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAATGCATAGATCCTGTTAAAATATAATACTTTTTTGTTGTCATTTC[A/C]GATAGTCCTGGAGGAATGCTGGTGATTCCAGTAAAATCCAGTGATGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081026 Nonsense 431 599 8 8
Genomic Location:
Chromosome 2 (position 10861061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCCTGGATTTGATTCTTGCYTCTACAAAGCYGTGGGGAATMTACTTA[C/T]AGATAAAATCCCAGAATCAGCTGAGCCTCTCACTGGAGCTCCTCCGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/twqcic03