ndnl2

Ensembl ID:
ENSDARG00000058212
ZFIN ID:
ZDB-GENE-031107-3
Description:
necdin-like 2 [Source:RefSeq peptide;Acc:NP_942107]
Human Orthologues:
MAGEB16, MAGED1, MAGED2, MAGED4, MAGED4B, MAGEE1, MAGEE2, MAGEF1, MAGEL2, NDN, NDNL2, TRO
Human Descriptions:
MAGE-like 2 [Source:HGNC Symbol;Acc:6814]
melanoma antigen family B, 16 [Source:HGNC Symbol;Acc:21188]
melanoma antigen family D, 1 [Source:HGNC Symbol;Acc:6813]
melanoma antigen family D, 2 [Source:HGNC Symbol;Acc:16353]
melanoma antigen family D, 4 [Source:HGNC Symbol;Acc:23793]
melanoma antigen family D, 4B [Source:HGNC Symbol;Acc:22880]
melanoma antigen family E, 1 [Source:HGNC Symbol;Acc:24934]
melanoma antigen family E, 2 [Source:HGNC Symbol;Acc:24935]
melanoma antigen family F, 1 [Source:HGNC Symbol;Acc:29639]
necdin homolog (mouse) [Source:HGNC Symbol;Acc:7675]
necdin-like 2 [Source:HGNC Symbol;Acc:7677]
trophinin [Source:HGNC Symbol;Acc:12326]
Mouse Orthologues:
Mageb16, Maged1, Maged2, Magee1, Magee2, Magel2, Ndn, Ndnl2, Tro
Mouse Descriptions:
melanoma antigen family B, 16 Gene [Source:MGI Symbol;Acc:MGI:1919217]
melanoma antigen, family D, 1 Gene [Source:MGI Symbol;Acc:MGI:1930187]
melanoma antigen, family D, 2 Gene [Source:MGI Symbol;Acc:MGI:1933391]
melanoma antigen, family E, 1 Gene [Source:MGI Symbol;Acc:MGI:2148149]
melanoma antigen, family E, 2 Gene [Source:MGI Symbol;Acc:MGI:2148316]
melanoma antigen, family L, 2 Gene [Source:MGI Symbol;Acc:MGI:1351648]
necdin Gene [Source:MGI Symbol;Acc:MGI:97290]
necdin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913897]
trophinin Gene [Source:MGI Symbol;Acc:MGI:1928994]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16522 Nonsense Available for shipment Available now
sa37641 Nonsense Mutation detected in F1 DNA During 2017
sa37640 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081038 Nonsense 18 260 3 11
ENSDART00000109878   None 70 None 6
ENSDART00000123043 Nonsense 18 220 2 9
ENSDART00000138807   None 120 None 5
Genomic Location (Zv9):
Chromosome 23 (position 13024250)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13156183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTATAATAATGTTGTAATTCTCTCTCTTAATTCCCTKTAACTGCAG[C/T]GATCACAGTTATTGCTGGAGGAAGAKGAGGATGCAAACTTCAGCCAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081038 Nonsense 89 260 5 11
ENSDART00000109878   None 70 None 6
ENSDART00000123043 Nonsense 89 220 4 9
ENSDART00000138807   None 120 None 5
Genomic Location (Zv9):
Chromosome 23 (position 13021187)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13153120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCCTGCAGACATTGGAAAACATGTGATAAAGGACTACAAACACATCTA[T/A]GCGGAAGTCATGAACAGAGTTTGCCGTACATTTGAGCAGGTACAATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081038 Essential Splice Site 175 260 8 11
ENSDART00000109878 Essential Splice Site 35 70 2 6
ENSDART00000123043 Essential Splice Site 175 220 7 9
ENSDART00000138807 Essential Splice Site 35 120 2 5
Genomic Location (Zv9):
Chromosome 23 (position 13017011)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13148944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTAGATCTGGTGTGGAATACACTCAAGAAGCTGCGGTTGGATCCAGG[G/T]TTTGTTGCCTAGAACCTTTTAGGAAAAATTTCTTATATTGTTAAGTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link