LOC565309

Ensembl ID:
ENSDARG00000058206
Human Orthologues:
AP001055.7, C21orf33
Human Description:
chromosome 21 open reading frame 33 [Source:HGNC Symbol;Acc:1273]
Mouse Orthologue:
D10Jhu81e
Mouse Description:
DNA segment, Chr 10, Johns Hopkins University 81 expressed Gene [Source:MGI Symbol;Acc:MGI:1351861]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10170 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081039 Nonsense 170 225 4 4
Genomic Location:
Chromosome 14 (position 11659289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGTTGTCATTTTTTTCTTAACTGCAGGTGGCCATATGCTCAAGTGGCA[C/T]AATCCATGGCAGAACTGGGCTGCAARCATGTCAATAAGCATGTTGGCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ezvpdz42