cxcr7b

Ensembl ID:
ENSDARG00000058179
ZFIN ID:
ZDB-GENE-031116-61
Description:
chemokine (C-X-C motif) receptor 7b [Source:RefSeq peptide;Acc:NP_001077301]
Human Orthologue:
CXCR7
Human Description:
chemokine (C-X-C motif) receptor 7 [Source:HGNC Symbol;Acc:23692]
Mouse Orthologue:
Cxcr7
Mouse Description:
chemokine (C-X-C motif) receptor 7 Gene [Source:MGI Symbol;Acc:MGI:109562]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16 Nonsense Available for shipment Available now
sa11907 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063665 Nonsense 76 362 2 2
Genomic Location:
Chromosome 6 (position 15653378)
KASP Assay ID:
554-0062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAACGCTCTGGTGGTTTGGGTGAACGTGAGAGCCGAGAGGACACGTTA[T/G]GAGACTCACCTGTACATCCTCAACCTAGCCATCGCTGACCTTTGTGTGGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

72 hpf

72 hpf

zoom

Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
lateral line
ZFA:0001469
neuromast
ZFA:0000243
present in fewer numbers in organism
PATO:0001997
abnormal
PATO:0000460
Adult
ZFS:0000044
whole organism
ZFA:0001094

viable
PATO:0000719
normal
PATO:0000461
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
7:69530101-69530472 69530472 1 1.82 × 10-09 0.6 18 rpl13 ENSDARG00000030585
14:6931001-6931500 6932431 1 1.00 × 10-05 -1.8 -3 hnrnpab ENSDARG00000007960
16:26027910-26028200 26027910 -1 1.00 × 10-05 0.5 1 rps27.2 ENSDARG00000055475
16:34481898-34482500 34481898 -1 1.10 × 10-05 0.8 2 kpna5 ENSDARG00000042030
23:27916801-27917000 27918151 1 4.20 × 10-05 0.7 -2 rps26 ENSDARG00000037071

Mutation Details

Allele Name:
sa11907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063665 Nonsense 207 362 2 2
Genomic Location:
Chromosome 6 (position 15652985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCCATYGTCTGCAAAGCAGTTTAYCCAGTGGAAAGCATGAAGGAGTG[G/A]ACGGTTGGCATCCAAATGAGCTTCTTCATGCTTGGCTTTGMCATTCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mc29adv5