si:dkey-11p10.6

Ensembl ID:
ENSDARG00000058178
ZFIN ID:
ZDB-GENE-091117-30
Human Orthologue:
ZDHHC20
Human Description:
zinc finger, DHHC-type containing 20 [Source:HGNC Symbol;Acc:20749]
Mouse Orthologue:
Zdhhc20
Mouse Description:
zinc finger, DHHC domain containing 20 Gene [Source:MGI Symbol;Acc:MGI:1923215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15347 Nonsense Available for shipment Available now
sa24508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080997 Nonsense 42 397 1 12
ENSDART00000136860 Nonsense 30 385 1 13
Genomic Location (Zv9):
Chromosome 24 (position 25612472)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24859350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTCAAGGAAGAAGAAAGATGGCGCCTACACATGTATTGAGATGCTG[C/A]CAGAGGGGTCTGGCGTGGATACCGGTGATATTTATTGCTTTAGTGGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080997 Nonsense 56 397 1 12
ENSDART00000136860 Nonsense 44 385 1 13
Genomic Location (Zv9):
Chromosome 24 (position 25612431)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24859309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCTGCCAGAGGGGTCTGGCGTGGATACCGGTGATATTTATTGCTT[T/A]AGTGGTGTGCTGGTCGTATTATGCATACGTGGTGGAGTTGTGTCTACGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link