si:dkey-196h17.3

Ensembl ID:
ENSDARG00000058160
ZFIN ID:
ZDB-GENE-081107-56
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIB7]
Human Orthologue:
TNFAIP2
Human Description:
tumor necrosis factor, alpha-induced protein 2 [Source:HGNC Symbol;Acc:11895]
Mouse Orthologue:
Tnfaip2
Mouse Description:
tumor necrosis factor, alpha-induced protein 2 Gene [Source:MGI Symbol;Acc:MGI:104960]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22211 Nonsense Available for shipment Available now
sa28061 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1956 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa22211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080975 Nonsense 312 613 4 11
ENSDART00000143326 Nonsense 8 309 1 8
Genomic Location (Zv9):
Chromosome 13 (position 6787188)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7114035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGAGGGATGGGAAGCTTCCACAGCTGATGGACCAGGTGTACTGCTG[T/A]CCTCAGGCCATCGATGTGATCCAGGTAAGGAAGAAAACTATGGATCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080975 Essential Splice Site 519 613 9 11
ENSDART00000143326 Essential Splice Site 215 309 6 8
Genomic Location (Zv9):
Chromosome 13 (position 6782246)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7118977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCCTCTGCTTCAACAGTGAACGCATACATACTTTCCTCACTTCAGCT[G/A]TAAGTACTCACCAAAACAAGTGCATCAGACATGCCATGTATCATTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1956
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080975 Essential Splice Site 520 613 10 11
ENSDART00000143326 Essential Splice Site 216 309 7 8
Genomic Location (Zv9):
Chromosome 13 (position 6782105)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7119118
KASP Assay ID:
554-1944.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACAAATATGTCGGTTACATCATGACATTATTCTAATGCTTTATTTCC[A/G]GGGTTCAAACATGGACTGGTTGAAAGACWTTCTTCCCAAGTTAGCCGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link