dnajc5b

Ensembl ID:
ENSDARG00000058147
ZFIN ID:
ZDB-GENE-050413-1
Human Orthologue:
DNAJC5B
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 5 beta [Source:HGNC Symbol;Acc:24138]
Mouse Orthologue:
Dnajc5b
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 5 beta Gene [Source:MGI Symbol;Acc:MGI:1913576]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37895 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080963 Nonsense 104 193 3 5
Genomic Location (Zv9):
Chromosome 24 (position 25426652)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24673530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGTTTGGAGAAGAGAACGTCAACACGTACTTCATGCTCTCCAGCTG[G/A]TGGGCGAAGGTGCACTATCACTCTTTTTCCTACACAGTGGAAATATTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
  • Response to statin therapy: Genome-wide study of gene variants associated with differential cardiovascular event reduction by pravastatin therapy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link