atp7b

Ensembl ID:
ENSDARG00000058145
Human Orthologue:
ATP7B
Human Description:
ATPase, Cu++ transporting, beta polypeptide [Source:HGNC Symbol;Acc:870]
Mouse Orthologue:
Atp7b
Mouse Description:
ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:103297]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20647 Nonsense Mutation detected in F1 DNA During 2014
sa17744 Nonsense Available for shipment Available now
sa9976 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030246 Nonsense 141 1364 2 21
Genomic Location:
Chromosome 6 (position 10007213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGTGTCATTGGAGTCCAGGTGTCTTTGAGCGATAAAGAAGCCATTT[T/A]GAGGTTTAACCCTGCAAAGGTAACACCAGAGGATATGAGAAAGCGTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030246 Nonsense 572 1364 7 21
Genomic Location:
Chromosome 6 (position 10018473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTKGGATCCCAGTGATKGGYCTGATGATCTACATGATGGTGATGGACAGT[C/T]AGCACAAGGAACATGGAGGCTCCATGCCTGCGGACCAGAACATCCTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030246 Essential Splice Site 757 1364 11 21
Genomic Location:
Chromosome 6 (position 10024616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGTGGTTCAACTGTAAACATACAAAATCTKACATTATTTGTMATTTC[A/C]GGAGAGCCGATGCCGGTGATWAAGAAAGCAGGCAGTTGTGTGATCGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pe4a7uxo