Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
atp7b
- Ensembl ID:
- ENSDARG00000058145
- Human Orthologue:
- ATP7B
- Human Description:
- ATPase, Cu++ transporting, beta polypeptide [Source:HGNC Symbol;Acc:870]
- Mouse Orthologue:
- Atp7b
- Mouse Description:
- ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:103297]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20647 | Nonsense | Mutation detected in F1 DNA | During 2015 |
| sa17744 | Nonsense | Available for shipment | Available now |
| sa9976 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20647
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2015.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000030246 | Nonsense | 141 | 1364 | 2 | 21 |
- Genomic Location:
- Chromosome 6 (position 10007213)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGGTGTCATTGGAGTCCAGGTGTCTTTGAGCGATAAAGAAGCCATTT[T/A]GAGGTTTAACCCTGCAAAGGTAACACCAGAGGATATGAGAAAGCGTATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17744
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000030246 | Nonsense | 572 | 1364 | 7 | 21 |
- Genomic Location:
- Chromosome 6 (position 10018473)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTKGGATCCCAGTGATKGGYCTGATGATCTACATGATGGTGATGGACAGT[C/T]AGCACAAGGAACATGGAGGCTCCATGCCTGCGGACCAGAACATCCTCCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9976
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000030246 | Essential Splice Site | 757 | 1364 | 11 | 21 |
- Genomic Location:
- Chromosome 6 (position 10024616)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAGTGGTTCAACTGTAAACATACAAAATCTKACATTATTTGTMATTTC[A/C]GGAGAGCCGATGCCGGTGATWAAGAAAGCAGGCAGTTGTGTGATCGCAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
- Connect with us:
Wellcome Trust Sanger Institute, Genome Research Limited (reg no. 2742969) is a charity registered in England with number 1021457
Last modified:
Last modified: