atp7b
- Ensembl ID:
- ENSDARG00000058145
- Human Orthologue:
- ATP7B
- Human Description:
- ATPase, Cu++ transporting, beta polypeptide [Source:HGNC Symbol;Acc:870]
- Mouse Orthologue:
- Atp7b
- Mouse Description:
- ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:103297]
Alleles
There are 7 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa33814 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa40636 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa20647 |
Nonsense |
Available for shipment |
Available now |
sa33815 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa17744 |
Nonsense |
Available for shipment |
Available now |
sa9976 |
Essential Splice Site |
Available for shipment |
Available now |
sa40637 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa33814
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Nonsense |
39 |
1364 |
1 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10004831)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9858638 |
GRCz11 |
6 |
10094177 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCGGCGGAGAGCAGCTCTGCATGAAGGACTGCAAACCCCTGTGCCACTG[C/A]GACCCGGAGCTCTGCGTTTGCTCTTTACCACAGAATAGTAAAGATGGACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40636
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Nonsense |
134 |
1364 |
2 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10007192)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9860999 |
GRCz11 |
6 |
10096538 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGAACAAATTGGTCGTCTTGAAGGTGTCATTGGAGTCCAGGTGTCTT[T/A]GAGCGATAAAGAAGCCATTTTGAGGTTTAACCCTGCAAAGGTAACACCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20647
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Nonsense |
141 |
1364 |
2 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10007213)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9861020 |
GRCz11 |
6 |
10096559 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGGTGTCATTGGAGTCCAGGTGTCTTTGAGCGATAAAGAAGCCATTT[T/A]GAGGTTTAACCCTGCAAAGGTAACACCAGAGGATATGAGAAAGCGTATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33815
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Nonsense |
282 |
1364 |
2 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10007635)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9861442 |
GRCz11 |
6 |
10096981 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCAGAGTGTCACCATTGGAATAGAAGGAATGACATGCAACTCTTGTGTT[C/T]AAGCCATTGAGGGGATGATGTCCCAGAGAGCTGGGGTATGCTCCATAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17744
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Nonsense |
572 |
1364 |
7 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10018473)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9872280 |
GRCz11 |
6 |
10107819 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTKGGATCCCAGTGATKGGYCTGATGATCTACATGATGGTGATGGACAGT[C/T]AGCACAAGGAACATGGAGGCTCCATGCCTGCGGACCAGAACATCCTCCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9976
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Essential Splice Site |
757 |
1364 |
11 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10024616)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9878423 |
GRCz11 |
6 |
10113962 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTCAGTGGTTCAACTGTAAACATACAAAATCTKACATTATTTGTMATTTC[A/C]GGAGAGCCGATGCCGGTGATWAAGAAAGCAGGCAGTTGTGTGATCGCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40637
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000030246 |
Nonsense |
855 |
1364 |
13 |
21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10027027)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
9880834 |
GRCz11 |
6 |
10116373 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTGTGTGTTAAAAATGCTTCTTATCTGTGTGTGATTTCTACAGGGTTA[C/A]AACCAAAACATCTCGCGAACAGAGGTGATCGTTCGCTTTGCCTTCCAGGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: