msna

Ensembl ID:
ENSDARG00000058128
ZFIN ID:
ZDB-GENE-021211-2
Description:
moesin [Source:RefSeq peptide;Acc:NP_001004296]
Human Orthologue:
MSN
Human Description:
moesin [Source:HGNC Symbol;Acc:7373]
Mouse Orthologue:
Msn
Mouse Description:
moesin Gene [Source:MGI Symbol;Acc:MGI:97167]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1265 Nonsense Available for shipment Available now
sa20388 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18450 Nonsense Available for shipment Available now
sa267 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016214 Nonsense 21 579 2 14
ENSDART00000112536 Nonsense 20 578 2 14
ENSDART00000124048 Nonsense 21 579 2 14
Genomic Location:
Chromosome 5 (position 23934905)
KASP Assay ID:
554-1180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCAGTGTTCGTGTGACTACAATGGATGCCGAGCYGGAGTTTGCCATC[C/T]AACCCAGCACCACAGGGAAACAGTTATTTGACCAGGTTTGTGTGTGGCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016214 Essential Splice Site 156 579 5 14
ENSDART00000112536 Essential Splice Site 155 578 5 14
ENSDART00000124048 Essential Splice Site 156 579 5 14
Genomic Location:
Chromosome 5 (position 23943408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCCACACTCCTGGATACTTGTCCAATGAGAAGCTGCTCCCACAGAGG[T/C]GTGCATATGCAGATATTGTTGTAGCAGTGAAAACACATTGAGGAAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016214 Nonsense 291 579 9 14
ENSDART00000112536 Nonsense 290 578 9 14
ENSDART00000124048 Nonsense 291 579 9 14
Genomic Location:
Chromosome 5 (position 23947300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATTAAWAAGAGGATTCTGGCTCTGTGCATGGGGAAYCATGAGCTTTA[T/A]ATGAGACGCCGTAAACCAGACACCATCGAGGTCCAGCAGATGAAGGCAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa267
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016214 Nonsense 308 579 9 14
ENSDART00000112536 Nonsense 307 578 9 14
ENSDART00000124048 Nonsense 308 579 9 14
Genomic Location:
Chromosome 5 (position 23947349)
KASP Assay ID:
554-2755.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGAGACGCCGTAAACCAGACACCATCGAGGTCCAGCAGATGAAGGCA[C/T]AGGCCAAGGAGGAAAAGAACCACAAGAAGATGGAAAGGTGAAGAAACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wvul0m05