fgfr2

Ensembl ID:
ENSDARG00000058115
ZFIN IDs:
ZDB-GENE-030323-1, ZDB-GENE-030323-1, ZDB-GENE-030323-1, ZDB-GENE-030323-1
Description:
Fibroblast growth factor receptor 2 [Source:UniProtKB/Swiss-Prot;Acc:Q8JG38]
Human Orthologue:
FGFR2
Human Description:
fibroblast growth factor receptor 2 [Source:HGNC Symbol;Acc:3689]
Mouse Orthologue:
Fgfr2
Mouse Description:
fibroblast growth factor receptor 2 Gene [Source:MGI Symbol;Acc:MGI:95523]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10729 Nonsense Available for shipment Available now
hu2987 Nonsense Available for shipment Available now
sa24945 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007408 Nonsense 421 817 9 18
ENSDART00000080914 Nonsense 419 815 9 18
ENSDART00000080916 Nonsense 444 840 8 18
ENSDART00000098269 Nonsense 355 751 8 17
Genomic Location:
Chromosome 13 (position 46957498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAGAAGCCTGATTTCAGCAGTCAGCCAGCAGTGCACAAGCTCACCAAA[C/T]AGATCCCCCWGCGCCGCCAGGTAACAGAAAGTAGATAAAGAGTTCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007408 Nonsense 547 817 12 18
ENSDART00000080914 Nonsense 545 815 12 18
ENSDART00000080916 Nonsense 570 840 11 18
ENSDART00000098269 Nonsense 481 751 11 17
Genomic Location:
Chromosome 13 (position 46933179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAGATGATGAAGATGATTGGCCGGCACAAGAACATCATCAATCTGT[T/A]GGGAGCGTGCACACAGGATGGTGAGGGATTTATTTTCACTATAGAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007408 Essential Splice Site 554 817 12 18
ENSDART00000080914 Essential Splice Site 552 815 12 18
ENSDART00000080916 Essential Splice Site 577 840 11 18
ENSDART00000098269 Essential Splice Site 488 751 11 17
Genomic Location:
Chromosome 13 (position 46933157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGGCACAAGAACATCATCAATCTGTTGGGAGCGTGCACACAGGATGG[T/G]GAGGGATTTATTTTCACTATAGAAAGCCTACATTATCAGTCCTCTAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A combined analysis of genome-wide association studies in breast cancer. (View Study)
  • Breast cancer: A genome-wide association study identifies a genetic variant in the SIAH2 locus associated with hormonal receptor-positive breast cancer in Japanese. (View Study)
  • Breast cancer: A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. (View Study)
  • Breast cancer: A multistage genome-wide association study in breast cancer identifies two new risk alleles at 1p11.2 and 14q24.1 (RAD51L1). (View Study)
  • Breast cancer: Common genetic variants and modification of penetrance of BRCA2-associated breast cancer. (View Study)
  • Breast cancer: Genetic variants associated with breast cancer risk for Ashkenazi Jewish women with strong family histories but no identifiable BRCA1/2 mutation. (View Study)
  • Breast cancer: Genome-wide association study identifies five new breast cancer susceptibility loci. (View Study)
  • Breast cancer: Genome-wide association study identifies novel breast cancer susceptibility loci. (View Study)
  • Breast cancer: Novel breast cancer susceptibility locus at 9q31.2: results of a genome-wide association study. (View Study)
  • Prostate-specific antigen levels: Genetic correction of PSA values using sequence variants associated with PSA levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/md31k91e