LOC798252

Ensembl ID:
ENSDARG00000058108
Human Orthologue:
EPS8L2
Human Description:
EPS8-like 2 [Source:HGNC Symbol;Acc:21296]
Mouse Orthologue:
Eps8l2
Mouse Description:
EPS8-like 2 Gene [Source:MGI Symbol;Acc:MGI:2138828]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17020 Nonsense Available for shipment Available now
sa3315 Essential Splice Site F2 line generated During 2014
sa18373 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104926 Nonsense 155 670 6 20
Genomic Location:
Chromosome 25 (position 4160627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACAACTTGCAAACAGGGGCATAATAACAWGCGTTTGTGTTTTAGGCC[G/T]AGATGGTGCACGCTGACATTGATAGCGCTCTGGGAGACAAYGCACGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3315
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104926 Essential Splice Site 335 670 12 20
Genomic Location:
Chromosome 25 (position 4174219)
KASP Assay ID:
554-3385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGCAAATTGAAAACTGTGTTGTTTTNNTGTGTGTGTTTRTGAGTTTA[G/A]AWCCTGCAGAGTTCTGGCAGTCCCGATCTCCCACGTGCCGTCATCTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104926 Essential Splice Site 384 670 13 20
Genomic Location:
Chromosome 25 (position 4176165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATGATGATGATGTTGTCTAATTCTGGACATGTCTTTGTGTATCCTA[G/A]AGCTGACTGGCCGAAAGATCAGTGCGCTCCTCTGTATGTCCCGAAGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/328v4cki